ID: 922331255_922331262

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 922331255 922331262
Species Human (GRCh38) Human (GRCh38)
Location 1:224578491-224578513 1:224578543-224578565
Sequence CCTTGTTTTTGATCCCCTGTATT GAGTCTCTCATTTTGGTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 260} {0: 1, 1: 0, 2: 2, 3: 9, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!