ID: 922335811_922335822

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 922335811 922335822
Species Human (GRCh38) Human (GRCh38)
Location 1:224617411-224617433 1:224617436-224617458
Sequence CCGCCGGGCGCGCCTTCGGTGCC GGCTGGAGGCGAGGGGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55} {0: 1, 1: 0, 2: 4, 3: 51, 4: 561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!