ID: 922335833_922335841

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 922335833 922335841
Species Human (GRCh38) Human (GRCh38)
Location 1:224617475-224617497 1:224617496-224617518
Sequence CCTCTGCAGGGCCCGACTGGGCG CGTCCCGGGTCCCGGGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 11, 4: 144} {0: 1, 1: 0, 2: 2, 3: 26, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!