ID: 922340009_922340024

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 922340009 922340024
Species Human (GRCh38) Human (GRCh38)
Location 1:224647661-224647683 1:224647704-224647726
Sequence CCCCACTTCTAGAGAGGACAGAG GTGTGGCTGGGTGGCACAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 192} {0: 1, 1: 0, 2: 3, 3: 34, 4: 445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!