ID: 922350627_922350634

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 922350627 922350634
Species Human (GRCh38) Human (GRCh38)
Location 1:224732243-224732265 1:224732273-224732295
Sequence CCCATAATTGGGTGCAGGTGAGG AGCCTCTAGGCTGCGTGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 85} {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!