|
Left Crispr |
Right Crispr |
| Crispr ID |
922350730 |
922350733 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:224732916-224732938
|
1:224732946-224732968
|
| Sequence |
CCTGGCAATTAGTAAGTTCTCAG |
AAGAAAAAAAAGAATGAGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 20, 3: 215, 4: 1252} |
{0: 1, 1: 4, 2: 134, 3: 1414, 4: 11460} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|