ID: 922358388_922358398

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 922358388 922358398
Species Human (GRCh38) Human (GRCh38)
Location 1:224798117-224798139 1:224798162-224798184
Sequence CCCCATATAGTTTTGGTGGGGCA TGGAGGTGGACTAGTTCCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!