ID: 922367589_922367594

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 922367589 922367594
Species Human (GRCh38) Human (GRCh38)
Location 1:224880617-224880639 1:224880633-224880655
Sequence CCGGAGAATCTCCGACCTGTTTG CTGTTTGCACACTGGGAAGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!