ID: 922368935_922368939

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922368935 922368939
Species Human (GRCh38) Human (GRCh38)
Location 1:224890593-224890615 1:224890632-224890654
Sequence CCTTGAGAAGCTATAGGGTATAG TATGGATGTACCTTCTTGTTGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 5, 3: 28, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!