ID: 922370579_922370586

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922370579 922370586
Species Human (GRCh38) Human (GRCh38)
Location 1:224906819-224906841 1:224906858-224906880
Sequence CCATGTGCATAAACTGTTCACCA CAGAGTGGGCTGAGGGAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 158} {0: 1, 1: 0, 2: 2, 3: 25, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!