ID: 922370581_922370586

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 922370581 922370586
Species Human (GRCh38) Human (GRCh38)
Location 1:224906839-224906861 1:224906858-224906880
Sequence CCACTGCTGCAGGTGACTTCAGA CAGAGTGGGCTGAGGGAATATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 24, 4: 188} {0: 1, 1: 0, 2: 2, 3: 25, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!