|
Left Crispr |
Right Crispr |
| Crispr ID |
922406954 |
922406956 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:225324073-225324095
|
1:225324091-225324113
|
| Sequence |
CCCAAAGTGCTGGGTTTATAGGC |
TAGGCATGAGCCGCCGCCCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 126, 1: 21788, 2: 250515, 3: 272843, 4: 172909} |
{0: 1, 1: 37, 2: 1673, 3: 21509, 4: 96914} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|