ID: 922455465_922455476

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 922455465 922455476
Species Human (GRCh38) Human (GRCh38)
Location 1:225770490-225770512 1:225770538-225770560
Sequence CCCCTTTCCCACCTTCCCTACCG CCTGCCGCTGTTTGCTAATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 857} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!