ID: 922455568_922455580

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 922455568 922455580
Species Human (GRCh38) Human (GRCh38)
Location 1:225771093-225771115 1:225771129-225771151
Sequence CCTGACCCAGCTTCCCCCAGAGG GGTGGCCTTTGCGATACCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!