ID: 922474553_922474560

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 922474553 922474560
Species Human (GRCh38) Human (GRCh38)
Location 1:225898318-225898340 1:225898340-225898362
Sequence CCTTGCCCGAGGTCGCAGATTGT TTAACGAGAGCACTGTAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 52} {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!