ID: 922474554_922474562

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 922474554 922474562
Species Human (GRCh38) Human (GRCh38)
Location 1:225898323-225898345 1:225898345-225898367
Sequence CCCGAGGTCGCAGATTGTTAACG GAGAGCACTGTAGGGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16} {0: 1, 1: 0, 2: 0, 3: 20, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!