ID: 922526530_922526537

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 922526530 922526537
Species Human (GRCh38) Human (GRCh38)
Location 1:226308783-226308805 1:226308796-226308818
Sequence CCCAGGGGCCGCTCTTCCCTCCA CTTCCCTCCACCTCGGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 202} {0: 1, 1: 0, 2: 1, 3: 13, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!