ID: 922537576_922537584

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 922537576 922537584
Species Human (GRCh38) Human (GRCh38)
Location 1:226392531-226392553 1:226392578-226392600
Sequence CCTTGAAAGAGCAGCATATCAGG ATCTCCTCCCCTTTCTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160} {0: 1, 1: 0, 2: 3, 3: 35, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!