ID: 922546233_922546238

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 922546233 922546238
Species Human (GRCh38) Human (GRCh38)
Location 1:226459326-226459348 1:226459351-226459373
Sequence CCATCTAATTGGCTGCCAGCCCA TAGAAAAAGCAGGAAGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 25, 3: 244, 4: 751} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!