ID: 922558836_922558843

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 922558836 922558843
Species Human (GRCh38) Human (GRCh38)
Location 1:226552469-226552491 1:226552484-226552506
Sequence CCCCAACATGGCCAGAGAGTTTG AGAGTTTGTCTAGTGGTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 167} {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!