ID: 922560712_922560717

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 922560712 922560717
Species Human (GRCh38) Human (GRCh38)
Location 1:226567578-226567600 1:226567607-226567629
Sequence CCAGTAAACTTTATTTCCCAGAG CTATACAAAGAGATCGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 255} {0: 1, 1: 0, 2: 0, 3: 9, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!