ID: 922564055_922564066

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 922564055 922564066
Species Human (GRCh38) Human (GRCh38)
Location 1:226589753-226589775 1:226589786-226589808
Sequence CCCTGTCCCTGCTGCAGAGGACC TCCAGCCCTGAGTCATGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 320} {0: 1, 1: 0, 2: 3, 3: 20, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!