ID: 922570105_922570119

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 922570105 922570119
Species Human (GRCh38) Human (GRCh38)
Location 1:226629562-226629584 1:226629597-226629619
Sequence CCTCAGTCGAGGACATACAAGGG GGCAGGGGCTGGGGGCTGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 33, 3: 326, 4: 2249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!