ID: 922575422_922575429

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 922575422 922575429
Species Human (GRCh38) Human (GRCh38)
Location 1:226658209-226658231 1:226658241-226658263
Sequence CCTTCACTGGGGAAAAGCCTGGT AGGCTGCAGAGTGGAGGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177} {0: 1, 1: 0, 2: 7, 3: 83, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!