ID: 922580727_922580733

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 922580727 922580733
Species Human (GRCh38) Human (GRCh38)
Location 1:226695861-226695883 1:226695881-226695903
Sequence CCAGGGGGCAAGACAGTAAGATG ATGAGGGAAGAGAGGGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168} {0: 1, 1: 1, 2: 7, 3: 194, 4: 2043}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!