ID: 922597055_922597061

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 922597055 922597061
Species Human (GRCh38) Human (GRCh38)
Location 1:226822194-226822216 1:226822220-226822242
Sequence CCTCCCACCACTGCTGAGTGCAG CACACTTTAGATACTGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 407} {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!