ID: 922603587_922603595

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 922603587 922603595
Species Human (GRCh38) Human (GRCh38)
Location 1:226874981-226875003 1:226875013-226875035
Sequence CCACCCTTTTCCCTGGCTGCTTC GAGAACTCTGCCTGGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 613} {0: 1, 1: 0, 2: 5, 3: 24, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!