ID: 922608203_922608207

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 922608203 922608207
Species Human (GRCh38) Human (GRCh38)
Location 1:226904345-226904367 1:226904361-226904383
Sequence CCTGCATATTTAGCACTGCTCAC TGCTCACCTCCCAGGGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75} {0: 1, 1: 1, 2: 2, 3: 43, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!