ID: 922608203_922608209

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 922608203 922608209
Species Human (GRCh38) Human (GRCh38)
Location 1:226904345-226904367 1:226904369-226904391
Sequence CCTGCATATTTAGCACTGCTCAC TCCCAGGGTCCTGGGCACTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 33, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!