ID: 922623039_922623049

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 922623039 922623049
Species Human (GRCh38) Human (GRCh38)
Location 1:227005966-227005988 1:227006004-227006026
Sequence CCCCAATCTTTTTCAGACCAGGA GCTGACACAAGTCCAGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 490} {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!