ID: 922627176_922627182

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 922627176 922627182
Species Human (GRCh38) Human (GRCh38)
Location 1:227060488-227060510 1:227060533-227060555
Sequence CCAGCAACAATGTGACAAATGCT TTGTATGGGAACCTAGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 236} {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!