ID: 922640085_922640100

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 922640085 922640100
Species Human (GRCh38) Human (GRCh38)
Location 1:227221531-227221553 1:227221579-227221601
Sequence CCACCCACCCTCCCTTCCCACTA TATTTCAACAGAAAAATAATAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 9, 3: 187, 4: 2330} {0: 1, 1: 0, 2: 5, 3: 81, 4: 1000}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!