ID: 922641740_922641741

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 922641740 922641741
Species Human (GRCh38) Human (GRCh38)
Location 1:227239250-227239272 1:227239286-227239308
Sequence CCAGGGGTCAGTGGTGAGGGAGA ACAGAGCACAGAAGATTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 479} {0: 1, 1: 3, 2: 43, 3: 245, 4: 786}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!