ID: 922642126_922642132

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 922642126 922642132
Species Human (GRCh38) Human (GRCh38)
Location 1:227244998-227245020 1:227245035-227245057
Sequence CCCAGCAAGTCAGAACGAGTTTC CACTGCAGGCTGAAGTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84} {0: 3, 1: 25, 2: 70, 3: 191, 4: 765}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!