ID: 922668938_922668952

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 922668938 922668952
Species Human (GRCh38) Human (GRCh38)
Location 1:227494591-227494613 1:227494628-227494650
Sequence CCCGGCTCCACATCCACAAGCAC ACCTGCCACCTGACGGGGGCGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 20, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!