ID: 922672048_922672057

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 922672048 922672057
Species Human (GRCh38) Human (GRCh38)
Location 1:227517591-227517613 1:227517636-227517658
Sequence CCTTTGAAAGGCATGTTAGAAAA GGGCAGTATTTTTAGTTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!