ID: 922682760_922682763

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 922682760 922682763
Species Human (GRCh38) Human (GRCh38)
Location 1:227614502-227614524 1:227614525-227614547
Sequence CCTTCTTCCCTATTTATAAAAAA ATCACCTTTCTTCCAACAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 854} {0: 1, 1: 0, 2: 3, 3: 23, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!