ID: 922700534_922700539

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 922700534 922700539
Species Human (GRCh38) Human (GRCh38)
Location 1:227757070-227757092 1:227757097-227757119
Sequence CCTTTCTCTGTGGCTCCAGGGGC CCATTCTCACATTTGAGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 365} {0: 1, 1: 0, 2: 8, 3: 43, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!