ID: 922728237_922728244

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 922728237 922728244
Species Human (GRCh38) Human (GRCh38)
Location 1:227936027-227936049 1:227936051-227936073
Sequence CCCACGCTCTGCCCTCACTCCTT CTGCATCTTGTTATGCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 369} {0: 1, 1: 0, 2: 4, 3: 10, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!