ID: 922728241_922728245

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 922728241 922728245
Species Human (GRCh38) Human (GRCh38)
Location 1:227936046-227936068 1:227936067-227936089
Sequence CCTTCCTGCATCTTGTTATGCAG AGCAGGGCCTCCACCTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 173} {0: 1, 1: 0, 2: 3, 3: 41, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!