ID: 922729384_922729395

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 922729384 922729395
Species Human (GRCh38) Human (GRCh38)
Location 1:227941967-227941989 1:227942000-227942022
Sequence CCCCAGGGTCCAGAGCCTCCAGG GCCTGTGTGCTCTTTCCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 53, 4: 410} {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!