ID: 922730269_922730289

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 922730269 922730289
Species Human (GRCh38) Human (GRCh38)
Location 1:227945810-227945832 1:227945860-227945882
Sequence CCCCTCCCCAGCCCAACCTTGGG CCAGCAGCCCAGATGGAACCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 73, 4: 631} {0: 1, 1: 0, 2: 3, 3: 14, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!