ID: 922730656_922730661

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 922730656 922730661
Species Human (GRCh38) Human (GRCh38)
Location 1:227947450-227947472 1:227947467-227947489
Sequence CCAGCCTTTTGGCAAGGACACGG ACACGGCGGCCCAAGGAAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 137} {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!