ID: 922747556_922747559

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 922747556 922747559
Species Human (GRCh38) Human (GRCh38)
Location 1:228053313-228053335 1:228053331-228053353
Sequence CCTCACACCATCTGTAAAAATCA AATCAATTACAAATCCCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 242, 4: 1607} {0: 1, 1: 0, 2: 0, 3: 18, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!