ID: 922748313_922748336

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 922748313 922748336
Species Human (GRCh38) Human (GRCh38)
Location 1:228059540-228059562 1:228059587-228059609
Sequence CCCACCTAAACGGGGCAGTACTC TGGGGGTGGGGCTCCTACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23} {0: 1, 1: 0, 2: 1, 3: 34, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!