ID: 922753788_922753803

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 922753788 922753803
Species Human (GRCh38) Human (GRCh38)
Location 1:228083043-228083065 1:228083075-228083097
Sequence CCCTGCCCCCGCCCGTCGCCCGG TGGACGCCGGGCTCTTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 434} {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!