ID: 922753802_922753805

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 922753802 922753805
Species Human (GRCh38) Human (GRCh38)
Location 1:228083070-228083092 1:228083083-228083105
Sequence CCGCTTGGACGCCGGGCTCTTCT GGGCTCTTCTCCAGGAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86} {0: 1, 1: 0, 2: 4, 3: 25, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!