ID: 922753810_922753818

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 922753810 922753818
Species Human (GRCh38) Human (GRCh38)
Location 1:228083117-228083139 1:228083143-228083165
Sequence CCCTCGCCTCTGCCTTTCTCGTT CGAGGCCGCCCGCGCGTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 282} {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!