ID: 922753814_922753833

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 922753814 922753833
Species Human (GRCh38) Human (GRCh38)
Location 1:228083129-228083151 1:228083175-228083197
Sequence CCTTTCTCGTTTCCCGAGGCCGC GCGGCCGCGGGGGCCGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71} {0: 1, 1: 0, 2: 5, 3: 103, 4: 890}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!