ID: 922753817_922753837

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 922753817 922753837
Species Human (GRCh38) Human (GRCh38)
Location 1:228083142-228083164 1:228083183-228083205
Sequence CCGAGGCCGCCCGCGCGTGGACG GGGGGCCGGTGGGGGTCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57} {0: 1, 1: 1, 2: 6, 3: 52, 4: 675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!